AA170, AA170 (genetic_marker) Pisum sativum

Marker Overview
NameAA170
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA170.Forward Primer: gtgcacaaggtgaaatgaatga
Primer 2AA170.Reverse Primer: ttgatgagttaaatcccgaagg
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA170.Forward PrimerPisum sativumprimer
Reverse PrimerAA170.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA170AA170Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-AlfettaxCDCBronco-RILLGVII-1N/A8.9AA170View
2pea-KaspaxParafield-RILLGIIIN/A101.4AA170View
3Pea-Integrated_Map-Sudheesh-2015LG3N/A40.76AA170View
4Pea-Composite_Map-Sudheesh-2015LG3N/A36.77AA170View