AA175, AA175 (genetic_marker) Pisum sativum

Marker Overview
NameAA175
AliasPSMPSAA175
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA175.Forward Primer: ttgaaggaacacaatcagcgac
Primer 2AA175.Reverse Primer: tgcgcaccaaactaccataatc
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA175.Forward PrimerPisum sativumprimer
Reverse PrimerAA175.Reverse PrimerPisum sativumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Cold toleranceqCTOL.TeresexChampagne.LG3.1.mon0001Pisum sativumQTL
Cold toleranceqCTOL.TeresexChampagne.LG3.1.mon0102Pisum sativumQTL
Cold toleranceqCTOL.TeresexChampagne.LG3.1.mon0203Pisum sativumQTL
Cold toleranceqCTOL.TeresexChampagne.LG3.1.cle0102Pisum sativumQTL
Cold toleranceqCTOL.TeresexChampagne.LG3.1.cle0203Pisum sativumQTL
Cold toleranceqCTOL.TeresexChampagne.LG3.1.dij0001Pisum sativumQTL
Cold toleranceqCTOL.TeresexChampagne.LG3.1.dij0102Pisum sativumQTL
Cold toleranceqCTOL.TeresexChampagne.LG3.1.dij0203Pisum sativumQTL
Cold toleranceqCTOL.TeresexChampagne.LG3.1.col0102Pisum sativumQTL
Cold toleranceqCTOL.TeresexChampagne.LG3.1.lus0102Pisum sativumQTL
Mycosphaerella pinodes resistanceqMPR.JI296xDP.LGIII.mpIII-3.%HT3.FC.stemPisum sativumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA175AA175Pisum sativummarker_locus
PSMPSAA175PSMPSAA175Pisum sativummarker_locus
AA175-282AA175-282-37.7Pisum sativummarker_locus
AA175-282AA175-282-37.6Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-TeresexChampagne-RIL-2009LG3N/A40.4AA175View
2Pea-IFPI3260/IFPI3251-RILLG03N/A76.88AA175View
3pea-compositeMap-2006LGIIIN/A43.6AA175View
4pea-TeresexChampagne-RILLGIIIa.2N/A44.5AA175View
5pea-consensusMap-2011LGIIIN/A39.4AA175View
6pea-microsatComposite-2005LGIIIN/A43.9AA175View
7pea-TeresexChampagne-RIL-2008LG3N/A10.4AA175View
8pea-PennantxPI595933-F2LG2N/A167.6AA175View
9pea-PennantxPI595933-F2LG7aN/A225.9AA175View
10Pea-JI1491_x_Cameor-RILLG3N/A28.6AA175View
11pea-JI296xDP-RIL-2004LGIIIN/A27PSMPSAA175View
12Pea-Baccara/PI180693_Duarte-RIL-2016LGIIIN/A37.7AA175-282-37.7View
13Pea-Baccara/PI180693_GBS-RIL-2016LGIIIN/A37.6AA175-282-37.6View