|
|
Marker Overview
| Name | AA175 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | AA175.Forward Primer: ttgaaggaacacaatcagcgac |
|---|
| Primer 2 | AA175.Reverse Primer: tgcgcaccaaactaccataatc |
|---|
| Publication | [view all] |
|---|
| Comment | Agrogène; PSMPS prefix for marker |
|---|
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2005 | Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31. |
| 2014 | Klein A, Houtin H, Rond C, Marget P, Jacquin F, Boucherot K, Huart M, Riviere N, Boutet G, Lejeune-Henaut I, Burstin J. QTL analysis of frost damage in pea suggests different mechanisms involved in frost tolerance. Theoretical and Applied Genetics. 2014; 127(6):1319-1330. |
|
