AA176, AA176 (genetic_marker) Pisum sativum

Marker Overview
NameAA176
AliasAA176-375
AA176_1
AA176_2
AA176_3
PSMPSAA176
PSAA176
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA176.Forward Primer: aacattgcatttcatgctga
Primer 2AA176.Reverse Primer: cccttgtgtagaagcatttgt
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA176.Forward PrimerPisum sativumprimer
Reverse PrimerAA176.Reverse PrimerPisum sativumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6bPisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.3Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.4Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.5Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.6Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.7Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.8Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.9Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.11Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.12Pisum sativumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA176-375AA176-375Pisum sativummarker_locus
AA176_2AA176_2Pisum sativummarker_locus
AA176_1AA176_1Pisum sativummarker_locus
AA176_3AA176_3Pisum sativummarker_locus
AA176AA176Pisum sativummarker_locus
PSMPSAA176PSMPSAA176Pisum sativummarker_locus
PSAA176PSAA176Pisum sativummarker_locus
AA176-397AA176-397-135Pisum sativummarker_locus
AA176-397AA176-397-116.4Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-ShawneexBohatyr-RILLGVII.3N/A216.5AA176-375View
2pea-microsatComposite-2005LGVIIN/A178.4AA176-375View
3pea-consensusMap-2011LGIIIN/A83.6AA176_2View
4pea-consensusMap-2011LGIIIN/A167.9AA176_1View
5pea-consensusMap-2011LGVN/A185.5AA176_3View
6pea-consensusMap-2011LGVIIN/A140.6AA176View
7Pea-Integrated_Map-Sudheesh-2015LG7N/A111.14AA176View
8Pea-Composite_Map-Sudheesh-2015LG7N/A111.75AA176View
9Pea-HUVP1_x_FC1-RILLGVIIN/A157.1AA176View
10pea-JI296xDP-F2:6-RILLG7N/A151PSMPSAA176View
11pea-JI296xDP-RIL-2004LGVIIN/A129PSMPSAA176View
12pea-DSPx90-2131-RIL-2015LGVIIN/A202.8PSAA176View
13Pea-Baccara/PI180693_Duarte-RIL-2016LGVIIN/A135AA176-397-135View
14Pea-Baccara/PI180693_GBS-RIL-2016LGVIIN/A116.4AA176-397-116.4View