AA176, AA176 (genetic_marker) Pisum sativum

Marker Overview
Genbank IDN/A
SpeciesPisum sativum
Primer 1AA176.Forward Primer: aacattgcatttcatgctga
Primer 2AA176.Reverse Primer: cccttgtgtagaagcatttgt
Publication[view all]
CommentAgrogène; PSMPS prefix for marker

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA176.Forward PrimerPisum sativumprimer
Reverse PrimerAA176.Reverse PrimerPisum sativumprimer

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6bPisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.3Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.4Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.5Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.6Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.7Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.8Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.9Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.11Pisum sativumQTL
Aphanomyces root rot resistanceqARR.BaccaraxPI180693.LGVII.Ps7.6b.12Pisum sativumQTL

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA176-375AA176-375Pisum sativummarker_locus
AA176_2AA176_2Pisum sativummarker_locus
AA176_1AA176_1Pisum sativummarker_locus
AA176_3AA176_3Pisum sativummarker_locus
AA176AA176Pisum sativummarker_locus
PSMPSAA176PSMPSAA176Pisum sativummarker_locus
PSAA176PSAA176Pisum sativummarker_locus
AA176-397AA176-397-135Pisum sativummarker_locus
AA176-397AA176-397-116.4Pisum sativummarker_locus

Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer