AA179, AA179 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AA179
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AA179.Forward Primer: tggaccagatgaaaattttgtt
Primer 2	AA179.Reverse Primer: gatgtatgtgaaggagagtagcg
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr2LG1	supercontig	chr2LG1:420279714..420280066 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGI	N/A	178.2	AA179	View
2	pea-TeresexChampagne-RIL	LGI.2	N/A	189.4	AA179	View
3	pea-consensusMap-2011	LGI	N/A	138.7	AA179	View
4	pea-microsatComposite-2005	LGI	N/A	158.6	AA179	View
5	pea-PennantxPI595933-F2	LG2	N/A	20.8	AA179	View
6	pea-TeresexChampagne-RIL-2009	LG1	N/A	161.5	AA179	View
7	pea-ShawneexBohatyr-RIL	LGVII.3	N/A	231.7	AA179-277	View
8	pea-microsatComposite-2005	LGVII	N/A	195.1	AA179-277	View
9	Pea-Baccara/PI180693_Duarte-RIL-2016	LGI	N/A	128.2	AA179-371	View