AA18, AA18 (genetic_marker) Pisum sativum

Marker Overview
NameAA18
AliasAA18-175
AA18-210
PSMPSAA18
AA18_210
PSAA18
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA18.Forward Primer: ctgtagaccaagcccaaaagat
Primer 2AA18.Reverse Primer: tgagacacttttgacaaggagg
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA18.Forward PrimerPisum sativumprimer
Reverse PrimerAA18.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA18-210AA18-210Pisum sativummarker_locus
AA18-175AA18-175Pisum sativummarker_locus
AA18AA18Pisum sativummarker_locus
PSMPSAA18PSMPSAA18Pisum sativummarker_locus
AA18_210AA18_210Pisum sativummarker_locus
PSAA18PSAA18Pisum sativummarker_locus
AA18-258AA18-258-24.4Pisum sativummarker_locus
AA18-258AA18-258-22.6Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-ShawneexBohatyr-RILLGIIa.3N/A45.7AA18-210View
2pea-microsatComposite-2005LGIIN/A34.2AA18-210View
3pea-ShawneexBohatyr-RILLGVb.3N/A133.1AA18-175View
4pea-microsatComposite-2005LGVN/A163.3AA18-175View
5pea-consensusMap-2011LGIIN/A24.3AA18View
6pea-KaspaxParafield-RILLGIIN/A50.2AA18View
7Pea-Integrated_Map-Sudheesh-2015LG2N/A54.08AA18View
8Pea-Composite_Map-Sudheesh-2015LG2N/A49.73AA18View
9pea-JI296xDP-F2:6-RILLG2N/A139PSMPSAA18View
10pea-JI296xDP-RIL-2004LGIIN/A141PSMPSAA18View
11pea-AlfettaxCDCBronco-RILLGII-2N/A33.7AA18_210View
12pea-DSPx90-2131-RIL-2015LGIIaN/A71.3PSAA18View
13Pea-Baccara/PI180693_Duarte-RIL-2016LGIIN/A24.4AA18-258-24.4View
14Pea-Baccara/PI180693_GBS-RIL-2016LGIIN/A22.6AA18-258-22.6View