AA205, AA205 (genetic_marker) Pisum sativum

Name	AA205
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AA205.Forward Primer: tacgcaatcatagagtttggaa
Primer 2	AA205.Reverse Primer: aatcaagtcaatgaaacaagca
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.
2015	Sudheesh S, Rodda M, Kennedy P, Verma P, Leonforte A, Cogan NOI, Materne M, Forster JW, Kaur S. Construction of an integrated linkage map and trait dissection for bacterial blight resistance in field pea (Pisum sativum L.). 2015; 35:185.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGII	N/A	181.7	AA205	View
2	pea-TeresexChampagne-RIL	LGII.2	N/A	116.1	AA205	View
3	pea-ShawneexBohatyr-RIL	LGIIb.3	N/A	44.3	AA205	View
4	pea-TeresexK586-RIL	LGII.1	N/A	136.2	AA205	View
5	pea-consensusMap-2011	LGII	N/A	161	AA205	View
6	pea-microsatComposite-2005	LGII	N/A	217.1	AA205	View
7	pea-PennantxPI595933-F2	LG2	N/A	146.4	AA205	View
8	pea-KaspaxParafield-RIL	LGII	N/A	269	AA205	View
9	Pea-DDR14/Explorer-F2	LG02	N/A	30.6	AA205	View
10	Pea-Integrated_Map-Sudheesh-2015	LG2	N/A	323.07	AA205	View
11	Pea-Composite_Map-Sudheesh-2015	LG2	N/A	311.23	AA205	View
12	Pea-Kaspa_x_PBA Oura-RIL	LG2	N/A	72.5	AA205	View
13	pea-TeresexChampagne-RIL-2009	LG2	N/A	152.4	AA205	View
14	pea-JI296xDP-RIL-2004	LGII	N/A	37	PSMPSAA205	View
15	pea-DSPx90-2131-RIL-2015	LGIIB	N/A	50.1	PSAA205	View
16	Pea-Baccara/PI180693_Duarte-RIL-2016	LGII	N/A	146	AA205-258	View
17	Pea-Baccara/PI180693_GBS-RIL-2016	LGII	N/A	134.7	AA205-258	View