AA238, AA238 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AA238
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AA238.Forward Primer: tatcatcaaggtccaatttagt
Primer 2	AA238.Reverse Primer: agctaaatcgtacctaatctgt
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr6LG2	supercontig	chr6LG2:37310903..37311102 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-TeresexChampagne-RIL	LGII.2	N/A	19.5	AA238	View
2	pea-consensusMap-2011	LGII	N/A	27.4	AA238	View
3	pea-microsatComposite-2005	LGII	N/A	35.6	AA238	View
4	pea-TeresexChampagne-RIL-2009	LG2	N/A	18.8	AA238	View
5	Pea-002067/Reward-F8-RIL	LG03	N/A	197.28	AA238	View
6	pea-JI296xDP-RIL-2004	LGII	N/A	141	PSMPSAA238	View
7	Pea-Baccara/PI180693_Duarte-RIL-2016	LGII	N/A	30.9	AA238-217	View
8	pea-BaccaraxPI180693-RIL	LGII	N/A	30.9	AA238-217	View
9	Pea-Baccara/PI180693_GBS-RIL-2016	LGII	N/A	27.8	AA238-217	View