AA258, AA258 (genetic_marker) Pisum sativum

Marker Overview
Genbank IDN/A
SpeciesPisum sativum
Primer 1AA258.Forward Primer: tctttgcttcctcatatgtgtc
Primer 2AA258.Reverse Primer: cgggattaaagtctcacattct
Publication[view all]
CommentAgrogène; PSMPS prefix for marker

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA258.Forward PrimerPisum sativumprimer
Reverse PrimerAA258.Reverse PrimerPisum sativumprimer

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Pea weevil resistanceqPWR.PennantxPI595933.LG7b.SCR7bPisum sp.QTL

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA258AA258Pisum sativummarker_locus
PSMPSAA258PSMPSAA258Pisum sativummarker_locus

Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer