AA321, AA321 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AA321
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AA321.Forward Primer: ctgcagcctgtacaagtgg
Primer 2	AA321.Reverse Primer: gtacatacaaacaaattccttcag
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold01051	supercontig	scaffold01051:11959..12269 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-ShawneexBohatyr-RIL	LGIb.3	N/A	108.9	AA321-134	View
2	pea-microsatComposite-2005	LGI	N/A	95.9	AA321-134	View
3	pea-consensusMap-2011	LGIV	N/A	53.5	AA321_1	View
4	Pea-Baccara/PI180693_Duarte-RIL-2016	LGII	N/A	94.4	AA321-255	View
5	pea-BaccaraxPI180693-RIL	LGII	N/A	94.4	AA321-255	View
6	Pea-Baccara/PI180693_GBS-RIL-2016	LGII	N/A	86.3	AA321-255	View