|
Marker Overview
Name | AA37 |
Genbank ID | N/A |
Type | SSR |
Species | Pisum sativum |
Primer 1 | AA37.Forward Primer: tccaccttcaaagttgatacagt |
Primer 2 | AA37.Reverse Primer: gggctttttagcttgtagacca |
Publication | [view all] |
Comment | Agrogène; PSMPS prefix for marker |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
Feature Name | Unique Name | Species | Type |
Forward Primer | AA37.Forward Primer | Pisum sativum | primer |
Reverse Primer | AA37.Reverse Primer | Pisum sativum | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
Publications
Year | Publication |
2005 | Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31. |
2014 | Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126. |
|