AA37, AA37 (genetic_marker) Pisum sativum

Marker Overview
NameAA37
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA37.Forward Primer: tccaccttcaaagttgatacagt
Primer 2AA37.Reverse Primer: gggctttttagcttgtagacca
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA37.Forward PrimerPisum sativumprimer
Reverse PrimerAA37.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA37_456AA37_456Pisum sativummarker_locus
AA37AA37Pisum sativummarker_locus
AA372.1_126AA372.1_126Pisum sativummarker_locus
PSMPSAA37PSMPSAA37Pisum sativummarker_locus
AA37AA37-63.6Pisum sativummarker_locus
AA37AA37-65.6Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-OrbxCDCStriker-RILLGI-2N/A51.4AA37_456View
2pea-OrbxCDCStriker-RIL-2010LGI-1N/A51.4AA37_456View
3pea-TeresexChampagne-RILLGI.2N/A97.3AA37View
4Pea-Composite_Map-RILLGIN/A83.1AA37View
5pea-ShawneexBohatyr-RILLGVII.3N/A81.7AA372.1_126View
6pea-JI296xDP-RIL-2004LGIN/A64PSMPSAA37View
7Pea-Baccara/PI180693_Duarte-RIL-2016LGIN/A63.6AA37View
8Pea-Baccara/PI180693_GBS-RIL-2016LGIN/A65.6AA37View