AA460, AA460 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AA460
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AA460.Forward Primer: tgtcagctgaattcacactctc
Primer 2	AA460.Reverse Primer: aaagacctcaaagtgtatgcgt
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr3LG5	supercontig	chr3LG5:425578553..425578758 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGV	N/A	205.2	AA460	View
2	pea-TeresexChampagne-RIL	LGV.2	N/A	184.4	AA460	View
3	pea-ShawneexBohatyr-RIL	LGVb.3	N/A	170.3	AA460	View
4	pea-TeresexK586-RIL	LGV.1	N/A	152.5	AA460	View
5	pea-consensusMap-2011	LGV	N/A	208.8	AA460	View
6	pea-microsatComposite-2005	LGV	N/A	185.5	AA460	View
7	pea-PennantxPI595933-F2	LG5	N/A	114.9	AA460	View
8	Pea-Baccara/PI180693_Duarte-RIL-2016	LGV	N/A	117.7	AA460-165	View
9	Pea-Baccara/PI180693_GBS-RIL-2016	LGV	N/A	123.8	AA460-165	View