AA473, AA473 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AA473
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AA473.Forward Primer: caatcgatcagacagtccccta
Primer 2	AA473.Reverse Primer: aagctcacctggttatgtccct
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr6LG2	supercontig	chr6LG2:17249293..17249599 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGII	N/A	9.5	AA473	View
2	pea-TeresexChampagne-RIL	LGII.2	N/A	0	AA473	View
3	pea-ShawneexBohatyr-RIL	LGIIa.3	N/A	15.9	AA473	View
4	pea-TeresexK586-RIL	LGII.1	N/A	10.5	AA473	View
5	pea-consensusMap-2011	LGII	N/A	10.9	AA473	View
6	pea-microsatComposite-2005	LGII	N/A	13.5	AA473	View
7	pea-PennantxPI595933-F2	LG1	N/A	66.5	AA473	View
8	pea-TeresexChampagne-RIL-2009	LG2	N/A	0	AA473	View
9	pea-JI296xDP-RIL-2004	LGII	N/A	162	PSMPSAA473	View
10	pea-DSPx90-2131-RIL-2015	LGIIa	N/A	20.6	PSAA473	View
11	Pea-Baccara/PI180693_Duarte-RIL-2016	LGII	N/A	13.2	AA473-343	View
12	pea-BaccaraxPI180693-RIL	LGII	N/A	13.2	AA473-343	View
13	Pea-Baccara/PI180693_GBS-RIL-2016	LGII	N/A	9.6	AA473-343	View