AA474, AA474 (genetic_marker) Pisum sativum

Marker Overview
Genbank IDN/A
SpeciesPisum sativum
Primer 1AA474.Forward Primer: gcccacacaagtggttctataaat
Primer 2AA474.Reverse Primer: attagtcgtttttctgaaacatcaaag
Publication[view all]
CommentAgrogène; PSMPS prefix for marker

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA474.Forward PrimerPisum sativumprimer
Reverse PrimerAA474.Reverse PrimerPisum sativumprimer

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Cold toleranceqCTOL.TeresexChampagne.LG1.1.cle0102Pisum sativumQTL

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA474AA474Pisum sativummarker_locus
PSAA474PSAA474Pisum sativummarker_locus
AA474-443AA474-443-53Pisum sativummarker_locus
AA474-443AA474-443-54.1Pisum sativummarker_locus

Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer