AA92, AA92 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AA92
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AA92.Forward Primer: aaggtctgaagctgaacctgaagg
Primer 2	AA92.Reverse Primer: gcagcccacagaagtgcttcaa
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr4LG4	supercontig	chr4LG4:186459003..186459427 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGIV	N/A	99.1	AA92	View
2	pea-TeresexChampagne-RIL	LGIVb.2	N/A	7.8	AA92	View
3	pea-ShawneexBohatyr-RIL	LGIVb.3	N/A	73.8	AA92	View
4	pea-consensusMap-2011	LGIV	N/A	121.8	AA92	View
5	pea-microsatComposite-2005	LGIV	N/A	101	AA92	View
6	pea-TeresexChampagne-RIL-2009	LG4	N/A	123.2	AA92	View
7	pea-JI296xDP-RIL-2004	LGIV	N/A	77	PSMPSAA92	View
8	pea-AlfettaxCDCBronco-RIL	LGVII-2	N/A	97.2	AA92_426/440	View
9	pea-ShawneexBohatyr-F7-RIL	LGIV	N/A	114	AA92_402	View
10	pea-DSPx90-2131-RIL-2015	LGIV	N/A	139.2	PSAA92	View
11	Pea-Baccara/PI180693_Duarte-RIL-2016	LGIV	N/A	74.8	AA92-386	View
12	Pea-Baccara/PI180693_GBS-RIL-2016	LGIV	N/A	69.3	AA92-386	View