|
|
Marker Overview
| Name | AA98 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | AA98.Forward Primer: gtgcagttgcaatttcgttt |
|---|
| Primer 2 | AA98.Reverse Primer: caaccaccgaaaaggaactc |
|---|
| Publication | [view all] |
|---|
| Comment | Agrogène; PSMPS prefix for marker |
|---|
Publications
| Year | Publication |
|---|
| 2005 | Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31. |
| 2015 | Rai R, Singh AK, Chand R, Srivastava CP, Joshi AK, Singh BD. Genomic regions controlling components of resistance for pea rust caused by Uromyces fabae (Pers.) de-Bary. 2015. |
|
