AB100, AB100 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AB100
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AB100.Forward Primer: cacaaataatggggaagtgacaaag
Primer 2	AB100.Reverse Primer: ggagatcatgaggaaagagacga
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold03700	supercontig	scaffold03700:42204..42646 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGII	N/A	75.3	AB100	View
2	pea-TeresexChampagne-RIL	LGII.2	N/A	58	AB100	View
3	pea-TeresexK586-RIL	LGII.1	N/A	71.4	AB100	View
4	pea-consensusMap-2011	LGII	N/A	72.3	AB100	View
5	pea-microsatComposite-2005	LGII	N/A	102	AB100	View
6	pea-TeresexChampagne-RIL-2009	LG2	N/A	66.6	AB100	View
7	Pea-Cheyenne/ZP0104-F5-RIL	LG02	N/A	227.9	AB100	View