AB130, AB130 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AB130
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AB130.Forward Primer: taggctgctctcttaggttattgagaga
Primer 2	AB130.Reverse Primer: gaacaaacacaagaaacatgttttagg
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr3LG5	supercontig	chr3LG5:189256012..189256321 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-ShawneexBohatyr-RIL	LGVb.3	N/A	46.7	AB130-219	View
2	pea-microsatComposite-2005	LGV	N/A	94.3	AB130-219	View
3	pea-consensusMap-2011	LGV	N/A	108.6	AB130	View
4	pea-PennantxPI595933-F2	LG3	N/A	211.8	AB130	View