AB149, AB149 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AB149
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AB149.Forward Primer: acaaaggatgatgaaagacccg
Primer 2	AB149.Reverse Primer: tcattactcaaagaatgcacccac
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr6LG2	supercontig	chr6LG2:377436356..377436577 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGII	N/A	125.8	AB149	View
2	pea-ShawneexBohatyr-RIL	LGIIa.3	N/A	143.5	AB149	View
3	pea-TeresexK586-RIL	LGII.1	N/A	111.2	AB149	View
4	pea-consensusMap-2011	LGII	N/A	128.5	AB149	View
5	pea-microsatComposite-2005	LGII	N/A	146.1	AB149	View
6	Pea-Cheyenne/ZP0104-F5-RIL	LG02	N/A	281.2	AB149	View
7	pea-DSPx90-2131-RIL-2015	LGIIB	N/A	19.3	PSAB149	View
8	Pea-Baccara/PI180693_Duarte-RIL-2016	LGII	N/A	137.5	AB149-279	View
9	pea-BaccaraxPI180693-RIL	LGII	N/A	137.5	AB149-279	View
10	Pea-Baccara/PI180693_GBS-RIL-2016	LGII	N/A	125.4	AB149-279	View