AB47, AB47 (genetic_marker) Pisum sativum

Marker Overview
NameAB47
AliasPSAB47
AB47a
AB47-486
PSMPSAB47
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AB47.Forward Primer: tccacaataccatctaaatgcca
Primer 2AB47.Reverse Primer: aatttgttcagttgaaatttcgtttc
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAB47.Forward PrimerPisum sativumprimer
Reverse PrimerAB47.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AB47AB47Pisum sativummarker_locus
AB47-486AB47-486Pisum sativummarker_locus
PSMPSAB47PSMPSAB47Pisum sativummarker_locus
PSAB47PSAB47Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-compositeMap-2006LGVN/A57.3AB47View
2pea-ShawneexBohatyr-RILLGVb.3N/A0AB47View
3pea-TeresexK586-RILLGV.1N/A56.8AB47View
4pea-consensusMap-2011LGVN/A69.4AB47View
5pea-TeresexChampagne-RIL-2009LG5N/A103.4AB47View
6pea-AlfettaxCDCBronco-RILLGIN/A12.9AB47View
7pea-PennantxPI595933-F2LG1N/A185.7AB47View
8pea-ShawneexBohatyr-RILLGIb.3N/A146AB47-486View
9pea-microsatComposite-2005LGIN/A121AB47-486View
10pea-microsatComposite-2005LGVN/A56.3AB47-486View
11pea-JI296xDP-RIL-2004LGVaN/A15PSMPSAB47View
12pea-DSPx90-2131-RIL-2015LGVN/A21.3PSAB47View