AB50, AB50 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AB50
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AB50.Forward Primer: atcctcgaagatcacgcagtta
Primer 2	AB50.Reverse Primer: atgtacttccttcgaatacgtctg
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr6LG2	supercontig	chr6LG2:121860046..121860236 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-TeresexK586-RIL	LGII.1	N/A	62.8	AB50.2	View
2	pea-microsatComposite-2005	LGII	N/A	96.6	AB50.2	View
3	pea-TeresexK586-RIL	LGVII.1	N/A	125.9	AB50.1	View
4	pea-microsatComposite-2005	LGVII	N/A	163	AB50.1	View
5	pea-consensusMap-2011	LGII	N/A	67.2	AB50_2	View
6	pea-consensusMap-2011	LGIV	N/A	145.8	AB50_3	View
7	pea-consensusMap-2011	LGVII	N/A	124.5	AB50_1	View
8	Pea-Baccara/PI180693_Duarte-RIL-2016	LGII	N/A	62.9	AB50-211	View
9	pea-BaccaraxPI180693-RIL	LGII	N/A	62.9	AB50-211	View
10	Pea-Baccara/PI180693_GBS-RIL-2016	LGII	N/A	54.8	AB50-211	View