AB85, AB85 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AB85
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AB85.Forward Primer: gattgagaccatatactcaccctatagtcc
Primer 2	AB85.Reverse Primer: cattctcatcctagactaatgcagtaacc
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr5LG3	supercontig	chr5LG3:572268626..572268891 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-ShawneexBohatyr-RIL	LGIIIc.3	N/A	28.6	AB85-284	View
2	pea-microsatComposite-2005	LGIII	N/A	282.8	AB85-284	View
3	pea-consensusMap-2011	LGIII	N/A	268.3	AB85	View
4	pea-ShawneexBohatyr-F7-RIL	LGIII	N/A	364.5	AB85_284	View