AB86, AB86 (genetic_marker) Pisum sativum

Marker Overview
NameAB86
AliasAB86_3
AB86-297
AB86_1
AB86_2
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AB86.Forward Primer: catgaagaagatgaagttgttgaagagt
Primer 2AB86.Reverse Primer: ttatggattagacatccatcattagctg
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAB86.Forward PrimerPisum sativumprimer
Reverse PrimerAB86.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AB86-297AB86-297Pisum sativummarker_locus
AB86_2AB86_2Pisum sativummarker_locus
AB86_3AB86_3Pisum sativummarker_locus
AB86_1AB86_1Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-ShawneexBohatyr-RILLGIa.3N/A24.6AB86-297View
2pea-microsatComposite-2005LGIN/A27.5AB86-297View
3pea-consensusMap-2011LGIVN/A66.4AB86_2View
4pea-consensusMap-2011LGVIN/A72.6AB86_3View
5pea-consensusMap-2011LGVIIN/A73.5AB86_1View