AB92, AB92 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AB92
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AB92.Forward Primer: attgtggattaagtccttgttatgaagg
Primer 2	AB92.Reverse Primer: ggacgacaatttgagatatgagagtg
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr5LG3	supercontig	chr5LG3:139821619..139822033 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGIII	N/A	98.7	AB92	View
2	pea-TeresexK586-RIL	LGIIIb.1	N/A	22.4	AB92	View
3	pea-consensusMap-2011	LGIII	N/A	80	AB92	View
4	pea-microsatComposite-2005	LGIII	N/A	95.8	AB92	View
5	Pea-Baccara/PI180693_Duarte-RIL-2016	LGIII	N/A	64.4	AB92-358	View
6	Pea-Baccara/PI180693_GBS-RIL-2016	LGIII	N/A	59.8	AB92-358	View