AC30, AC30 (genetic_marker) Pisum sativum

Marker Overview
NameAC30
AliasPSAC30
AC30-155
AC30-390
AC30_390
AC30_155
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AC30.Forward Primer: gcagcaagagtgacgaagttatc
Primer 2AC30.Reverse Primer: gcctgactaccacttctgctg
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAC30.Forward PrimerPisum sativumprimer
Reverse PrimerAC30.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AC30-155AC30-155Pisum sativummarker_locus
AC30-390AC30-390Pisum sativummarker_locus
AC30_390AC30_390Pisum sativummarker_locus
AC30_155AC30_155Pisum sativummarker_locus
PSAC30PSAC30Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-ShawneexBohatyr-RILLGIIIb.3N/A42.2AC30-155View
2pea-microsatComposite-2005LGIIIN/A133.9AC30-155View
3pea-ShawneexBohatyr-RILLGVb.3N/A10AC30-390View
4pea-microsatComposite-2005LGVN/A64.4AC30_390View
5pea-ShawneexBohatyr-F7-RILLGIIIN/A151.8AC30_155View
6pea-DSPx90-2131-RIL-2015LGIIIAN/A21.6PSAC30View