AC58, AC58 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AC58
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AC58.Forward Primer: tccgcaatttggtaacactg
Primer 2	AC58.Reverse Primer: cgtccatttcttttatgctgag
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr3LG5	supercontig	chr3LG5:411129824..411130029 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-OrbxCDCStriker-RIL	LGV	N/A	52.9	AC58	View
2	pea-compositeMap-2006	LGV	N/A	184.9	AC58	View
3	pea-TeresexChampagne-RIL	LGV.2	N/A	169.1	AC58	View
4	pea-consensusMap-2011	LGV	N/A	192.3	AC58	View
5	pea-microsatComposite-2005	LGV	N/A	167.3	AC58	View
6	Pea-DDR14/Explorer-F2	LG05	N/A	30.7	AC58	View
7	pea-ShawneexBohatyr-RIL	LGVb.3	N/A	148	AC58-205	View
8	pea-JI296xDP-RIL-2004	LGVb	N/A	26	PSMPSAC58	View
9	pea-DSPx90-2131-RIL-2015	LGV	N/A	112.9	PSAC58	View
10	Pea-Baccara/PI180693_Duarte-RIL-2016	LGV	N/A	103.9	AC58-235	View
11	Pea-Baccara/PI180693_GBS-RIL-2016	LGV	N/A	109.7	AC58-235	View