AC75, AC75 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AC75
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AC75.Forward Primer: cgctcaccaaatgtagatgataa
Primer 2	AC75.Reverse Primer: tcatgcatcaatgaaagtgataaa
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr2LG1	supercontig	chr2LG1:422011762..422012017 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGI	N/A	174.1	AC75	View
2	pea-TeresexChampagne-RIL	LGI.2	N/A	192	AC75	View
3	pea-consensusMap-2011	LGI	N/A	142.8	AC75	View
4	pea-microsatComposite-2005	LGI	N/A	154.5	AC75	View
5	pea-TeresexChampagne-RIL-2009	LG1	N/A	159	AC75	View
6	pea-JI296xDP-RIL-2004	LGI	N/A	123	PSMPSAC75	View
7	Pea-Baccara/PI180693_Duarte-RIL-2016	LGI	N/A	136.8	AC75-297	View
8	Pea-Baccara/PI180693_GBS-RIL-2016	LGI	N/A	114.9	AC75-297	View