ACCox, ACCox (genetic_marker) Pisum sativum

Marker Overview
NameACCox
Genbank IDCD859452
TypeCAPS
SpeciesPisum sativum
Primer 1ACCox.Forward Primer: GAATCATGGCATACCTCATGACC
Primer 2ACCox.Reverse Primer: GAGAAGGATGATCCCGCCAG
Restriction EnzymeMseI
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCD859427
DB:genbankCD859452
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerACCox.Forward PrimerPisum sativumprimer
Reverse PrimerACCox.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ACCoxACCoxPisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-CameorxChina-RILLGIN/A13.5ACCoxView
2pea-compositeMap-2006LGIN/A41.5ACCoxView
3pea-consensusMap-2014LGIN/A17.13ACCoxView
4pea-consensusMap-2011LGIN/A30.3ACCoxView
5Pea-Integrated_Map-Sudheesh-2015LG1N/A250.23ACCoxView
6Pea-JI1491_x_Cameor-RILLG1N/A16.6ACCoxView