AD148, AD148 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AD148
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AD148.Forward Primer: gaaacatcattgtgtcttcttg
Primer 2	AD148.Reverse Primer: ttccatcacttgattgataaac
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold05062	supercontig	scaffold05062:28115..28367 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGII	N/A	25.4	AD148	View
2	pea-TeresexChampagne-RIL	LGII.2	N/A	19.8	AD148	View
3	pea-TeresexK586-RIL	LGII.1	N/A	29.5	AD148	View
4	pea-consensusMap-2011	LGII	N/A	29.5	AD148	View
5	pea-microsatComposite-2005	LGII	N/A	39.3	AD148	View
6	pea-TeresexChampagne-RIL-2009	LG2	N/A	19.1	AD148	View
7	Pea-002067/Reward-F8-RIL	LG03	N/A	195.07	AD148	View
8	pea-PennantxPI595933-F2	LG7	N/A	361.9	AD148	View
9	pea-OrbxCDCStriker-RIL	LGII-2	N/A	11	AD148_190	View
10	pea-DSPx90-2131-RIL-2015	LGIIa	N/A	75.7	PSAD148	View
11	Pea-Baccara/PI180693_Duarte-RIL-2016	LGII	N/A	33.5	AD148-264	View
12	pea-BaccaraxPI180693-RIL	LGII	N/A	33.5	AD148-264	View
13	Pea-Baccara/PI180693_GBS-RIL-2016	LGII	N/A	28.8	AD148-264	View