AD155, AD155 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AD155
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AD155.Forward Primer: agtagtgaaatgctcactgcca
Primer 2	AD155.Reverse Primer: agtaagctcaaggatcgaacca
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr3LG5	supercontig	chr3LG5:304296745..304297088 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-consensusMap-2011	LGV	N/A	182.9	AD155	View
2	pea-ShawneexBohatyr-RIL	LGIVa.3	N/A	13.1	AD155-326	View
3	pea-ShawneexBohatyr-RIL	LGVb.3	N/A	117.5	AD155-350	View
4	pea-microsatComposite-2005	LGV	N/A	160.2	AD155-350	View
5	pea-microsatComposite-2005	LGIV	N/A	10	AD155_326	View
6	pea-ShawneexBohatyr-F7-RIL	LGIV	N/A	13.1	AD155_326	View
7	Pea-Baccara/PI180693_Duarte-RIL-2016	LGV	N/A	97.9	AD155-356	View
8	Pea-Baccara/PI180693_GBS-RIL-2016	LGV	N/A	104.1	AD155-356	View