AD186, AD186 (genetic_marker) Pisum sativum

Marker Overview


Name	AD186
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AD186.Forward Primer: tcaatgacgtgttgatcgagga
Primer 2	AD186.Reverse Primer: ccatgctttgcaccgaaagtaa
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr4LG4	supercontig	chr4LG4:46196434..46196733 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-PennantxPI595933-F2	LG1	N/A	27.1	AD186	View
2	pea-PennantxPI595933-F2	LG7	N/A	307.7	AD186	View
3	pea-compositeMap-2006	LGIV	N/A	29.3	AD186.2	View
4	pea-TeresexChampagne-RIL	LGIVa.2	N/A	13	AD186.2	View
5	pea-TeresexK586-RIL	LGIV.1	N/A	31.1	AD186.2	View
6	pea-microsatComposite-2005	LGIV	N/A	29.8	AD186.2	View
7	Pea-Composite_Map-RIL	LGIV	N/A	37.4	AD186.2	View
8	pea-TeresexChampagne-RIL-2009	LG4	N/A	25.3	AD186.2	View
9	pea-OrbxCDCStriker-RIL	LGII-2	N/A	0	AD186_221	View
10	pea-compositeMap-2006	LGII	N/A	23	AD186.1	View
11	pea-ShawneexBohatyr-RIL	LGIIa.3	N/A	48.7	AD186.1	View
12	pea-TeresexK586-RIL	LGII.1	N/A	26.7	AD186.1	View
13	pea-microsatComposite-2005	LGII	N/A	36.2	AD186.1	View
14	pea-compositeMap-2006	LGIV	N/A	111	AD186.b	View
15	pea-TeresexChampagne-RIL	LGIVb.2	N/A	16.5	AD186.b	View
16	pea-microsatComposite-2005	LGIV	N/A	112.5	AD186.b	View
17	Pea-Composite_Map-RIL	LGIV	N/A	93.1	AD186.b	View
18	pea-TeresexChampagne-RIL-2009	LG4	N/A	131.8	AD186.b	View
19	pea-consensusMap-2011	LGII	N/A	26	AD186_1	View
20	pea-consensusMap-2011	LGIV	N/A	59.2	AD186_2	View
21	pea-consensusMap-2011	LGIV	N/A	134.4	AD186_3	View
22	pea-DSPx90-2131-RIL-2015	LGIV	N/A	68.8	PSAD186	View
23	Pea-Baccara/PI180693_Duarte-RIL-2016	LGIV	N/A	27.5	AD186-314	View
24	Pea-Baccara/PI180693_GBS-RIL-2016	LGIV	N/A	24.3	AD186-314	View

Search form