AD57, AD57 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AD57
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AD57.Forward Primer: gttttcatgatggttaaaggtg
Primer 2	AD57.Reverse Primer: gagtaagcaaagtgactagtgga
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr5LG3	supercontig	chr5LG3:139655866..139656186 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGIII	N/A	99.1	AD57	View
2	pea-TeresexChampagne-RIL	LGIIIa.2	N/A	106.8	AD57	View
3	pea-ShawneexBohatyr-RIL	LGIIIb.3	N/A	0	AD57	View
4	pea-TeresexK586-RIL	LGIIIb.1	N/A	23.3	AD57	View
5	pea-consensusMap-2011	LGIII	N/A	80.2	AD57	View
6	pea-microsatComposite-2005	LGIII	N/A	96.2	AD57	View
7	pea-PennantxPI595933-F2	LG3	N/A	358.3	AD57	View
8	Pea-IFPI3260/IFPI3251-RIL	LG03	N/A	112.15	AD57	View
9	Pea-Cheyenne/ZP0104-F5-RIL	LG02	N/A	36.9	AD57	View
10	pea-ShawneexBohatyr-F7-RIL	LGIII	N/A	109.6	AD57_280	View
11	pea-DSPx90-2131-RIL-2015	LGIIIA	N/A	12.1	PSAD57	View
12	Pea-Baccara/PI180693_Duarte-RIL-2016	LGIII	N/A	64.7	AD57-300	View
13	pea-BaccaraxPI180693-RIL	LGIII	N/A	64.7	AD57-300	View
14	Pea-Baccara/PI180693_GBS-RIL-2016	LGIII	N/A	61.1	AD57-300	View