AF029243.2, AF029243.2 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AF029243.2
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AF029243.2.Forward Primer: catcagaggtgtcagctagg
Primer 2	AF029243.2.Reverse Primer: cagttaccgttgttggaagc
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr2LG1	supercontig	chr2LG1:36519662..36520100 .

Publications


Year	Publication
2001	Burstin J, Deniot G, Potier J, Weinachter C, Aubert G, Baranger A. Microsatellite polymorphism in Pisum sativum. Plant breeding = Zeitschrift für Pflanzenzüchtung. 2001 Aug; 120(4):311-317.
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.