AgpS1, AgpS1 (genetic_marker) Pisum sativum

Marker Overview
NameAgpS1
Genbank IDX96764
TypeCAPS
SpeciesPisum sativum
Primer 1AgpS1.Forward Primer: GTTTTAGCAATTGGGTATATGCTG
Primer 2AgpS1.Reverse Primer: GCAGATATATTAACAATTAACCGTAA
Restriction EnzymeSnaI
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankX96764
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAgpS1.Forward PrimerPisum sativumprimer
Reverse PrimerAgpS1.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
agps1agps1Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-CameorxChina-RILLGIIIN/A27.2agps1View
2pea-consensusMap-2014LGIIIN/A50.7agps1View
3pea-consensusMap-2011LGIIIN/A104.2agps1View
4Pea-Integrated_Map-Sudheesh-2015LG3N/A198.22agps1View
5Pea-JI1491_x_Cameor-RILLG3N/A90.2agps1View
6Pea-Attika_x_Isard-RIL-2016LGIIIN/A0agps1View
7Pea-Kaspa_x_Attika-RIL-2016LGIIIN/A29.1agps1View
8Pea-Consensus_RIL-2016LGIIIN/A89.9agps1View