AgpS2, AgpS2 (genetic_marker) Pisum sativum

Marker Overview
NameAgpS2
AliasAgps2
Genbank IDX96765
TypeCAPS
SpeciesPisum sativum
Primer 1AgpS2.Forward Primer: CACTCAATCGACATCTTTCTCGCG
Primer 2AgpS2.Reverse Primer: GCACCAGGAATCATCTCACTCCC
Restriction EnzymeSnaI
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankX96765
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAgpS2.Forward PrimerPisum sativumprimer
Reverse PrimerAgpS2.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
agps2agps2Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-TeresexChampagne-RIL-2009LG1N/A0agps2View
2pea-CameorxChina-RILLGIN/A0agps2View
3pea-compositeMap-2006LGIN/A0agps2View
4pea-consensusMap-2014LGIN/A3.51agps2View
5pea-consensusMap-2011LGIN/A4agps2View
6Pea-Integrated_Map-Sudheesh-2015LG1N/A292.27agps2View
7Pea-JI1491_x_Cameor-RILLG1N/A3.1agps2View
8Pea-Attika_x_Isard-RIL-2016LGIN/A9.2agps2View
9Pea-Kaspa_x_Attika-RIL-2016LGIN/A1.9agps2View
10Pea-Kaspa_x_Isard-RIL-2016LGIN/A0agps2View
11Pea-Consensus_RIL-2016LGIN/A18.6agps2View