B11, B11 (genetic_marker) Pisum sativum

Marker Overview
NameB11
AliasB11-490
B11-1700
B11_344
B11_363
B11_465
B11_590
B11-430
B11-465
B11-590
B11-368
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1B11.Forward Primer: aacccttgtgcagaagcattt
Primer 2B11.Reverse Primer: cttgatgaggcattggtggat
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerB11.Forward PrimerPisum sativumprimer
Reverse PrimerB11.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
B11_344B11_344Pisum sativummarker_locus
B11-430B11-430Pisum sativummarker_locus
B11_363B11_363Pisum sativummarker_locus
B11_465B11_465Pisum sativummarker_locus
B11_590B11_590Pisum sativummarker_locus
B11-465B11-465Pisum sativummarker_locus
B11-590B11-590Pisum sativummarker_locus
B11-368B11-368Pisum sativummarker_locus
B11-490B11-490Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-OrbxCDCStriker-RILLGIV-2N/A31.1B11_344View
2pea-OrbxCDCStriker-RIL-2010LGIV-2N/A31.1B11_344View
3pea-ShawneexBohatyr-RILLGIb.3N/A61.5B11-430View
4pea-microsatComposite-2005LGIN/A79.7B11-430View
5pea-ShawneexBohatyr-RILLGIVa.3N/A2.8B11_363View
6pea-microsatComposite-2005LGIVN/A0B11_363View
7pea-AlfettaxCDCBronco-RILLGIN/A44.8B11_363View
8pea-AlfettaxCDCBronco-RILLGIV-2N/A13B11_363View
9pea-ShawneexBohatyr-F7-RILLGIVN/A2.8B11_363View
10pea-ShawneexBohatyr-RILLGVb.3N/A67.6B11_465View
11pea-ShawneexBohatyr-RILLGVb.3N/A68.4B11_590View
12pea-microsatComposite-2005LGVN/A107.2B11-465View
13pea-microsatComposite-2005LGVN/A108B11-590View
14pea-PennantxPI595933-F2LG2N/A165.4B11-368View
15pea-PennantxPI595933-F2LG4N/A84.4B11-490View