|
|
Marker Overview
| Name | CHPSGPA1 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | CHPSGPA1.Forward Primer: gggttgttgatttggctgac |
|---|
| Primer 2 | CHPSGPA1.Reverse Primer: tgcacaatgaggagcaagag |
|---|
| Publication | [view all] |
|---|
Publications
| Year | Publication |
|---|
| 2001 | Burstin J, Deniot G, Potier J, Weinachter C, Aubert G, Baranger A. Microsatellite polymorphism in Pisum sativum. Plant breeding = Zeitschrift für Pflanzenzüchtung. 2001 Aug; 120(4):311-317. |
| 2005 | Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31. |
|
