CipPor, CipPor (genetic_marker) Pisum sativum

Marker Overview
NameCipPor
Genbank IDX63060
TypeSTS
SpeciesPisum sativum
Primer 1CipPor.Forward Primer: ACTGCTAAGGCTTTGGCTGA
Primer 2CipPor.Reverse Primer: AGATTTTGTTAGGCTTGGATCACT
Product Length1100
Restriction EnzymeAlu I
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankX63060
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCipPor.Forward PrimerPisum sativumprimer
Reverse PrimerCipPor.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CipPorCipPorPisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-Chi115xWL1238-F2LGIIIN/A121CipPorView