|
Marker Overview
Name | CKI1 |
Genbank ID | N/A |
Type | CAPS |
Species | Pisum sativum |
Primer 1 | CKI1.Forward Primer: AGAATTATGTTCAAGTTAAAGAG |
Primer 2 | CKI1.Reverse Primer: GAGAATCATCAACGACCATAA |
Restriction Enzyme | SnaBI |
Publication | [view all] |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
Feature Name | Unique Name | Species | Type |
Forward Primer | CKI1.Forward Primer | Pisum sativum | primer |
Reverse Primer | CKI1.Reverse Primer | Pisum sativum | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
Feature Name | Unique Name | Species | Type |
CKI1 | CKI1 | Pisum sativum | marker_locus |
Publications
Year | Publication |
2011 | Bordat A, Savois V, Nicolas M, Salse J, Chauveau A, Bourgeois M, Potier J, Houtin H, Rond C, Murat F, Marget P, Aubert G, Burstin J. Translational Genomics in Legumes Allowed Placing In Silico 5460 Unigenes on the Pea Functional Map and Identified Candidate Genes in Pisum sativum L. G3 (Bethesda, Md.). 2011 Jul; 1(2):93-103. |
Map Positions
# | Map Name | Linkage Group | Bin | Position | Locus | MapViewer |
1 | pea-consensusMap-2011 | LGII | N/A | 120.2 | CKI1 | View |
|