CKI1, CKI1 (genetic_marker) Pisum sativum

Marker Overview
NameCKI1
Genbank IDN/A
TypeCAPS
SpeciesPisum sativum
Primer 1CKI1.Forward Primer: AGAATTATGTTCAAGTTAAAGAG
Primer 2CKI1.Reverse Primer: GAGAATCATCAACGACCATAA
Restriction EnzymeSnaBI
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCKI1.Forward PrimerPisum sativumprimer
Reverse PrimerCKI1.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CKI1CKI1Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-consensusMap-2011LGIIN/A120.2CKI1View