|
|
Marker Overview
| Name | Clv2 |
|---|
| Genbank ID | N/A |
|---|
| Type | CAPS |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | Clv2.Forward Primer: GGCTTATTTGGCCTAGCTGGTC |
|---|
| Primer 2 | Clv2.Reverse Primer: CTGCCTTGATTAGATGGAAGCCTTC |
|---|
| Restriction Enzyme | HinfI |
|---|
| Publication | [view all] |
|---|
Publications
| Year | Publication |
|---|
| 2011 | Bordat A, Savois V, Nicolas M, Salse J, Chauveau A, Bourgeois M, Potier J, Houtin H, Rond C, Murat F, Marget P, Aubert G, Burstin J. Translational Genomics in Legumes Allowed Placing In Silico 5460 Unigenes on the Pea Functional Map and Identified Candidate Genes in Pisum sativum L. G3 (Bethesda, Md.). 2011 Jul; 1(2):93-103. |
|
