DRR230a, DRR230a (genetic_marker) Pisum sativum

Marker Overview
NameDRR230a
Genbank IDAF139018
Typegene marker
SpeciesPisum sativum
Primer 1DRR230a.Forward Primer: CCATGGAGAAGAAATCACTAGCTTG
Primer 2DRR230a.Reverse Primer: AGTGCACCAACAGCGAAAGTCATCC
Restriction EnzymeMseI
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAF139018
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerDRR230a.Forward PrimerPisum sativumprimer
Reverse PrimerDRR230a.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DRR230aDRR230aPisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-DSPx90-2131-RIL-2015LGIIIbN/A23.2DRR230aView