DRR230b, DRR230b (genetic_marker) Pisum sativum

Marker Overview
NameDRR230b
Genbank IDL01579
Typegene marker
SpeciesPisum sativum
Primer 1DRR230b.Forward Primer: TAAATCTATATTCATCATCACTAAAG
Primer 2DRR230b.Reverse Primer: CAGTTTTGAGTGCAGAAACATTTCCAG
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankL01579
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerDRR230b.Forward PrimerPisum sativumprimer
Reverse PrimerDRR230b.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DRR230bDRR230bPisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-DSPx90-2131-RIL-2015LGIIIbN/A23.2DRR230bView