FBPaldo, FBPaldo (genetic_marker) Pisum sativum

Marker Overview
NameFBPaldo
Genbank IDP46256
TypeSSCP
SpeciesPisum sativum
Primer 1FBPaldo.Forward Primer: hGTCTGCCTTTGTTGGAAAGTATG
Primer 2FBPaldo.Reverse Primer: GACACCAGAGAGGTATTGGAGTG
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankP46256
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerFBPaldo.Forward PrimerPisum sativumprimer
Reverse PrimerFBPaldo.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
FBPaldoFBPaldoPisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-compositeMap-2006LGIN/A9.9FBPaldoView
2pea-consensusMap-2011LGIN/A8.2FBPaldoView
3Pea-Composite_Map-RILLGIN/A4.8FBPaldoView
4Pea-Attika_x_Isard-RIL-2016LGIN/A10.6FBPaldoView
5Pea-Kaspa_x_Attika-RIL-2016LGIN/A3.1FBPaldoView
6Pea-Kaspa_x_Isard-RIL-2016LGIN/A4.9FBPaldoView
7Pea-Consensus_RIL-2016LGIN/A19.8FBPaldoView