|
|
Marker Overview
| Name | FBPaldo |
|---|
| Genbank ID | P46256 |
|---|
| Type | SSCP |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | FBPaldo.Forward Primer: hGTCTGCCTTTGTTGGAAAGTATG |
|---|
| Primer 2 | FBPaldo.Reverse Primer: GACACCAGAGAGGTATTGGAGTG |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | P46256 |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
| Feature Name | Unique Name | Species | Type |
|---|
| Forward Primer | FBPaldo.Forward Primer | Pisum sativum | primer |
| Reverse Primer | FBPaldo.Reverse Primer | Pisum sativum | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
| Feature Name | Unique Name | Species | Type |
|---|
| FBPaldo | FBPaldo | Pisum sativum | marker_locus |
Publications
| Year | Publication |
|---|
| 2006 | Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041. |
| 2014 | Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126. |
| 2016 | Ferrari B., Romani M., Aubert G., Boucherot K., Burstin J., Pecetti L., Huart-Naudet M., Klein A., Annicchiarico P. . Association of SNP Markers with Agronomic and Quality Traits of Field Pea in Italy. Czech Journal of Genetics and Plant Breeding. 2016; 52(3):83-93. |
|
