|
|
Marker Overview
| Name | Gs3B |
|---|
| Genbank ID | U28925 |
|---|
| Type | Indel |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | Gs3B.Forward Primer: GGGTCTTTCTTTTAAAGACCAAAGC |
|---|
| Primer 2 | Gs3B.Reverse Primer: GTATACTCTTGTTCAATACCATACC |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | U28925 |
Publications
| Year | Publication |
|---|
| 2006 | Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041. |
| 2015 | Rai R, Singh AK, Chand R, Srivastava CP, Joshi AK, Singh BD. Genomic regions controlling components of resistance for pea rust caused by Uromyces fabae (Pers.) de-Bary. 2015. |
|
