|
|
Marker Overview
| Name | MAX1 |
|---|
| Genbank ID | N/A |
|---|
| Type | CAPS |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | MAX1.Forward Primer: GCAGATGCAGAACTGTGTAAAG |
|---|
| Primer 2 | MAX1.Reverse Primer: CGCAGCAACCAAATAGACTA |
|---|
| Restriction Enzyme | AccI |
|---|
| Publication | [view all] |
|---|
Publications
| Year | Publication |
|---|
| 2012 | Weller JL, Liew LC, Hecht VF, Rajandran V, Laurie RE, Ridge S, Wenden B, Vander Schoor JK, Jaminon O, Blassiau C, Dalmais M, Rameau C, Bendahmane A, Macknight RC, Lejeune-Hénaut I. A conserved molecular basis for photoperiod adaptation in two temperate legumes. Proceedings of the National Academy of Sciences of the United States of America. 2012 Dec 18; 109(51):21158-63. |
|
