Myb3, Myb3 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	Myb3
Genbank ID	CD860209
Type	CAPS
Species	Pisum sativum
Primer 1	Myb3.Forward primer: TCTTCAGAACCAGAACCAGAACC
Primer 2	Myb3.Reverse primer: GCCTTTGTAATCCCAAACACCAGC
Restriction Enzyme	HpaII
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CD860209

Publications


Year	Publication
2011	Bordat A, Savois V, Nicolas M, Salse J, Chauveau A, Bourgeois M, Potier J, Houtin H, Rond C, Murat F, Marget P, Aubert G, Burstin J. Translational Genomics in Legumes Allowed Placing In Silico 5460 Unigenes on the Pea Functional Map and Identified Candidate Genes in Pisum sativum L. G3 (Bethesda, Md.). 2011 Jul; 1(2):93-103.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-consensusMap-2011	LGVII	N/A	113.9	Myb3	View