O2like, O2like (genetic_marker) Medicago truncatula | PulseDB

Marker Overview

Marker Overview


Name	O2like
Genbank ID	BI311616
Type	CAPS
Species	Medicago truncatula
Primer 1	O2like.Forward Primer: CTTGTGAACAAAGTACAAACCC
Primer 2	O2like.Reverse Primer: CACAAACTTGGATATTCTAACTGG
Restriction Enzyme	TaqI
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	BI311616

Publications


Year	Publication
2006	Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGII	N/A	19.9	O2like	View
2	pea-consensusMap-2011	LGII	N/A	21.6	O2like	View
3	pea-DSPx90-2131-RIL-2015	LGIIa	N/A	64.9	O2like	View