|
Marker Overview
Name | PBA_PS_0123 |
Genbank ID | N/A |
Type | SSR |
Species | Pisum sativum |
Primer 1 | PBA_PS_0123.Forward Primer: TAGCGTGGAATAGATCTTGTG |
Primer 2 | PBA_PS_0123.Reverse Primer: AAATCACAAGTGACGACGA |
Product Length | 143 |
Publication | [view all] |
Publications
Year | Publication |
2012 | Kaur S, Pembleton LW, Cogan NO, Savin KW, Leonforte T, Paull J, Materne M, Forster JW. Transcriptome sequencing of field pea and faba bean for discovery and validation of SSR genetic markers. BMC genomics. 2012; 13:104. |
2015 | Sudheesh S, Rodda M, Kennedy P, Verma P, Leonforte A, Cogan NOI, Materne M, Forster JW, Kaur S. Construction of an integrated linkage map and trait dissection for bacterial blight resistance in field pea (Pisum sativum L.). 2015; 35:185. |
|