PBA_PS_0171, PBA_PS_0171 (genetic_marker) Pisum sativum

Marker Overview
NamePBA_PS_0171
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1PBA_PS_0171.Forward Primer: GATTTCAGTGAGAAGCCAAA
Primer 2PBA_PS_0171.Reverse Primer: CTCAGAGAAACCTCTCTTTCC
Product Length156
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerPBA_PS_0171.Forward PrimerPisum sativumprimer
Reverse PrimerPBA_PS_0171.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PBA_PS_0171PBA_PS_0171Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-KaspaxParafield-RILLGIIN/A153.3PBA_PS_0171View
2Pea-Integrated_Map-Sudheesh-2015LG2N/A172.38PBA_PS_0171View
3Pea-Composite_Map-Sudheesh-2015LG2N/A153.22PBA_PS_0171View