Phos4kin, Phos4kin (genetic_marker) Medicago truncatula | PulseDB

Marker Overview

Marker Overview


Name	Phos4kin
Genbank ID	TC104076
Type	Indel
Species	Medicago truncatula
Primer 1	Phos4kin.Forward Primer: CGCCGAGCTGGTATAAAAAG
Primer 2	Phos4kin.Reverse Primer: TCCCCATCTCGGTCAACTAC
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	TC104076

Publications


Year	Publication
2011	Bordat A, Savois V, Nicolas M, Salse J, Chauveau A, Bourgeois M, Potier J, Houtin H, Rond C, Murat F, Marget P, Aubert G, Burstin J. Translational Genomics in Legumes Allowed Placing In Silico 5460 Unigenes on the Pea Functional Map and Identified Candidate Genes in Pisum sativum L. G3 (Bethesda, Md.). 2011 Jul; 1(2):93-103.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-consensusMap-2011	LGIII	N/A	1.4	Phos4kin	View